Product Details

SNP ID: rs9910731
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:32457016 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CCTGTTCCTTTGTGGAAATCCATTC[A/G]AGTGCTCTGCTATAGTTCGCTAGTA
Phenotype: MIM: 604449
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: PSMD11 PubMed Links
Additional Information: For this assay, SNP(s) [rs117946974] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270482.1		Intron			NP_001257411.1
NM_002815.3		Intron			NP_002806.2