Product Details
- SNP ID
-
rs800444
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:24798241 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTCTAAGTGCCAGACCCAAGTTTCC[A/G]ACTGTCTGCCCACCTGTCTTCCCAC
- Phenotype
-
MIM: 185490
- Polymorphism
- A/G, Transition substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC149
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs17882785] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC149
- Gene Name
- coiled-coil domain containing 149
There are no transcripts associated with this gene.
- Gene
- SOD3
- Gene Name
- superoxide dismutase 3, extracellular
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_003102.2 |
|
Intron |
|
|
NP_003093.2 |
View Full Product Details