Product Details

SNP ID
rs1614894
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.18:55227570 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATAAACACTAGCTGACTTGAATACC[A/C]ACAAAAACGTTCATGTAGTTTTCTT
Phenotype
MIM: 602272
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
TCF4 PubMed Links
Additional Information
For this assay, SNP(s) [rs115039389] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
TCF4
Gene Name
transcription factor 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001083962.1 2671 UTR 3 NP_001077431.1
NM_001243226.2 2671 UTR 3 NP_001230155.2
NM_001243227.1 2671 UTR 3 NP_001230156.1
NM_001243228.1 2671 UTR 3 NP_001230157.1
NM_001243230.1 2671 UTR 3 NP_001230159.1
NM_001243231.1 2671 UTR 3 NP_001230160.1
NM_001243232.1 2671 UTR 3 NP_001230161.1
NM_001243233.1 2671 UTR 3 NP_001230162.1
NM_001243234.1 2671 UTR 3 NP_001230163.1
NM_001243235.1 2671 UTR 3 NP_001230164.1
NM_001243236.1 2671 UTR 3 NP_001230165.1
NM_001306207.1 2671 UTR 3 NP_001293136.1
NM_001306208.1 2671 UTR 3 NP_001293137.1
NM_003199.2 2671 UTR 3 NP_003190.1
XM_005266739.3 2671 UTR 3 XP_005266796.2
XM_005266741.3 2671 UTR 3 XP_005266798.1
XM_005266743.4 2671 UTR 3 XP_005266800.1
XM_005266744.3 2671 UTR 3 XP_005266801.1
XM_005266745.3 2671 UTR 3 XP_005266802.1
XM_005266747.3 2671 UTR 3 XP_005266804.1
XM_005266749.3 2671 UTR 3 XP_005266806.1
XM_005266752.4 2671 UTR 3 XP_005266809.1
XM_005266754.3 2671 UTR 3 XP_005266811.1
XM_005266755.4 2671 UTR 3 XP_005266812.1
XM_005266761.3 2671 UTR 3 XP_005266818.1
XM_006722536.2 2671 UTR 3 XP_006722599.1
XM_006722537.2 2671 UTR 3 XP_006722600.1
XM_006722538.2 2671 UTR 3 XP_006722601.1
XM_011526158.2 2671 UTR 3 XP_011524460.1
XM_011526160.2 2671 UTR 3 XP_011524462.1
XM_017025934.1 2671 UTR 3 XP_016881423.1
XM_017025935.1 2671 UTR 3 XP_016881424.1
XM_017025936.1 2671 UTR 3 XP_016881425.1
XM_017025937.1 2671 UTR 3 XP_016881426.1
XM_017025938.1 2671 UTR 3 XP_016881427.1
XM_017025939.1 2671 UTR 3 XP_016881428.1
XM_017025940.1 2671 UTR 3 XP_016881429.1
XM_017025941.1 2671 UTR 3 XP_016881430.1
XM_017025942.1 2671 UTR 3 XP_016881431.1
XM_017025943.1 2671 UTR 3 XP_016881432.1
XM_017025944.1 2671 UTR 3 XP_016881433.1
XM_017025945.1 2671 UTR 3 XP_016881434.1
XM_017025946.1 2671 UTR 3 XP_016881435.1
XM_017025947.1 2671 UTR 3 XP_016881436.1
XM_017025948.1 2671 UTR 3 XP_016881437.1
XM_017025949.1 2671 UTR 3 XP_016881438.1
XM_017025950.1 2671 UTR 3 XP_016881439.1
XM_017025951.1 2671 UTR 3 XP_016881440.1
XM_017025952.1 2671 UTR 3 XP_016881441.1
XM_017025953.1 2671 UTR 3 XP_016881442.1
XM_017025954.1 2671 UTR 3 XP_016881443.1
XM_017025955.1 2671 UTR 3 XP_016881444.1
XM_017025956.1 2671 UTR 3 XP_016881445.1
XM_017025957.1 2671 UTR 3 XP_016881446.1

View Full Product Details