Product Details

SNP ID: rs75188962
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:8920120 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTAAGAGGTGAAACAAAATGTCACT[C/T]ATGTACAACTAGGCTTTATGGGAAG
Phenotype: MIM: 609191 MIM: 140750
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AKIP1 PubMed Links

Gene Details

Gene: AKIP1
Gene Name: A-kinase interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206646.1	2342	Intron			NP_001193575.1
NM_001206647.1	2342	Intron			NP_001193576.1
NM_001206648.1	2342	Intron			NP_001193577.1
NM_020642.3	2342	Intron			NP_065693.2
XM_017018011.1	2342	Intron			XP_016873500.1
XM_017018012.1	2342	Intron			XP_016873501.1

Gene: C11orf16
Gene Name: chromosome 11 open reading frame 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020643.2	2342	UTR 3			NP_065694.2
XM_017018013.1	2342	UTR 3			XP_016873502.1

Gene: ST5
Gene Name: suppression of tumorigenicity 5

There are no transcripts associated with this gene.

View Full Product Details