Product Details

SNP ID: rs75501939
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:10451524 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGCGGCAGGAAGGCGCACCCCCC[A/C]AGCAATCTGCGCGCCGGGACAGAAT
Phenotype: MIM: 609130 MIM: 602784 MIM: 601882
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: APITD1 PubMed Links

Gene Details

Gene: APITD1
Gene Name: apoptosis-inducing, TAF9-like domain 1

There are no transcripts associated with this gene.

Gene: APITD1-CORT
Gene Name: APITD1-CORT readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243768.1	752	Missense Mutation	AAG,CAG	K121Q	NP_001230697.1
NM_001270517.1	752	UTR 3			NP_001257446.1
NM_198544.3	752	Missense Mutation	AAG,CAG	K142Q	NP_940946.1
NM_199006.2	752	UTR 3			NP_950171.2

Gene: CORT
Gene Name: cortistatin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302.4	752	Missense Mutation	AAG,CAG	K83Q	NP_001293.3

Gene: DFFA
Gene Name: DNA fragmentation factor subunit alpha

There are no transcripts associated with this gene.

View Full Product Details