Product Details

SNP ID: rs78983534
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:128696167 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACTTCAGGCCAAGGATGGGAGTGA[A/C]AGTCCTTCCTTTTTTTGTGGGTGGT
Phenotype: MIM: 193067 MIM: 615815
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FLI1 PubMed Links

Gene Details

Gene: FLI1
Gene Name: Fli-1 proto-oncogene, ETS transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001167681.2		Intron			NP_001161153.1
NM_001271010.1		Intron			NP_001257939.1
NM_001271012.1		Intron			NP_001257941.1
NM_002017.4		Intron			NP_002008.2
XM_011542701.2		Intron			XP_011541003.1
XM_011542702.1		Intron			XP_011541004.1
XM_017017405.1		Intron			XP_016872894.1
XM_017017406.1		Intron			XP_016872895.1

Gene: LOC101929538
Gene Name: uncharacterized LOC101929538

There are no transcripts associated with this gene.

Gene: SENCR
Gene Name: smooth muscle and endothelial cell enriched migration/differentiation-associated long non-coding RNA

There are no transcripts associated with this gene.

View Full Product Details