Product Details

SNP ID: rs78181205
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:68044255 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTACCTGGCCCTGAACCAGTGCAGC[A/G]TGAGCACCACGCACAAGTGCCTCAT
Phenotype: MIM: 118491 MIM: 602141 MIM: 604592
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHKA PubMed Links

Gene Details

Gene: CHKA
Gene Name: choline kinase alpha

There are no transcripts associated with this gene.

Gene: MIR6753
Gene Name: microRNA 6753

There are no transcripts associated with this gene.

Gene: NDUFS8
Gene Name: NADH:ubiquinone oxidoreductase core subunit S8

There are no transcripts associated with this gene.

Gene: TCIRG1
Gene Name: T-cell immune regulator 1, ATPase H+ transporting V0 subunit a3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006019.3	1055	Missense Mutation	ATG,GTG	M311V	NP_006010.2
NM_006053.3	1055	Missense Mutation	ATG,GTG	M95V	NP_006044.1
XM_005273709.3	1055	Missense Mutation	ATG,GTG	M311V	XP_005273766.1
XM_011544726.2	1055	Missense Mutation	ATG,GTG	M311V	XP_011543028.1
XM_017017089.1	1055	Missense Mutation	ATG,GTG	M311V	XP_016872578.1
XM_017017090.1	1055	Missense Mutation	ATG,GTG	M13V	XP_016872579.1

View Full Product Details