Product Details

SNP ID

rs145187500

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.11:73958360 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TAAGCACCACCCGTTGAAGTCAAAT[A/G]AGCCGTCTTCAGCAGAGATTTTCAG

Phenotype

MIM: 610263

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

DNAJB13 PubMed Links

Additional Information

For this assay, SNP(s) [rs141051090] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DNAJB13

Gene Name

DnaJ heat shock protein family (Hsp40) member B13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153614.3	1120	Missense Mutation	AAG,GAG	K38E	NP_705842.2
XM_005273984.3	1120	Missense Mutation	AAG,GAG	K38E	XP_005274041.1
XM_011545004.2	1120	Missense Mutation	AAG,GAG	K72E	XP_011543306.1
XM_011545005.2	1120	Missense Mutation	AAG,GAG	K72E	XP_011543307.1
XM_011545007.2	1120	UTR 5			XP_011543309.1
XM_011545009.2	1120	UTR 5			XP_011543311.1
XM_011545013.2	1120	Missense Mutation	AAG,GAG	K72E	XP_011543315.1
XM_011545014.2	1120	Missense Mutation	AAG,GAG	K72E	XP_011543316.1
XM_011545015.2	1120	Intron			XP_011543317.1
XM_017017675.1	1120	UTR 5			XP_016873164.1
XM_017017676.1	1120	UTR 5			XP_016873165.1
XM_017017677.1	1120	UTR 5			XP_016873166.1
XM_017017678.1	1120	UTR 5			XP_016873167.1
XM_017017679.1	1120	Missense Mutation	AAG,GAG	K72E	XP_016873168.1

View Full Product Details