Product Details

SNP ID: rs146403821
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.12:107775717 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCGGCGCCTTCGCCCAGCAGCGAG[A/C]CCGAGGAGGGGGGCAGCTAGCGAGC
Phenotype: MIM: 609155
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: ASCL4 PubMed Links
Additional Information: For this assay, SNP(s) [rs201513808] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_203436.2	1333	Missense Mutation	ACC,CCC	T168P	NP_982260.2