Product Details

SNP ID

rs139961659

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:68271631 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AAGAGGAGGCTGTATCTCCAGCCAA[C/T]GCGCTCCTTCAGAGCCATGATTGCT

Phenotype

MIM: 610008 MIM: 603880

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ARSG PubMed Links

Additional Information

For this assay, SNP(s) [rs7222013] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ARSG

Gene Name

arylsulfatase G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267727.1	842	Intron			NP_001254656.1
NM_014960.4	842	Intron			NP_055775.2
XM_005257170.3	842	Intron			XP_005257227.1
XM_005257172.3	842	Intron			XP_005257229.1
XM_006721777.3	842	Intron			XP_006721840.2
XM_006721779.3	842	Intron			XP_006721842.1
XM_011524535.2	842	Intron			XP_011522837.1
XM_011524536.2	842	Intron			XP_011522838.1
XM_011524537.1	842	Intron			XP_011522839.1
XM_011524538.2	842	Intron			XP_011522840.1
XM_011524540.2	842	Intron			XP_011522842.1
XM_011524541.2	842	Intron			XP_011522843.1
XM_011524542.2	842	Intron			XP_011522844.1
XM_011524543.2	842	Intron			XP_011522845.1
XM_011524544.2	842	Intron			XP_011522846.1
XM_011524545.2	842	Intron			XP_011522847.1
XM_011524546.2	842	Intron			XP_011522848.1
XM_017024360.1	842	Intron			XP_016879849.1
XM_017024361.1	842	Intron			XP_016879850.1
XM_017024362.1	842	Intron			XP_016879851.1
XM_017024363.1	842	Intron			XP_016879852.1
XM_017024364.1	842	Intron			XP_016879853.1
XM_017024365.1	842	Intron			XP_016879854.1
XM_017024366.1	842	Intron			XP_016879855.1
XM_017024367.1	842	Intron			XP_016879856.1
XM_017024368.1	842	Intron			XP_016879857.1

Gene

SLC16A6

Gene Name

solute carrier family 16 member 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001174166.1	842	Missense Mutation	ATT,GTT	I177V	NP_001167637.1
NM_004694.4	842	Missense Mutation	ATT,GTT	I177V	NP_004685.2
XM_005257789.3	842	Missense Mutation	ATT,GTT	I181V	XP_005257846.2
XM_011525461.2	842	Missense Mutation	ATT,GTT	I177V	XP_011523763.1
XM_017025291.1	842	Missense Mutation	ATT,GTT	I177V	XP_016880780.1
XM_017025292.1	842	Missense Mutation	ATT,GTT	I177V	XP_016880781.1

View Full Product Details