Product Details

SNP ID: rs142040381
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1478787 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTCCCCCTACCTTCCGGGGCCAG[G/T]ATGGTGAACACTGGATCCTCTGCCG
Phenotype: MIM: 612034 MIM: 600487
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: APC2 PubMed Links

Gene Details

Gene: APC2
Gene Name: APC2, WNT signaling pathway regulator

There are no transcripts associated with this gene.

Gene: C19orf25
Gene Name: chromosome 19 open reading frame 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152482.2	202	Silent Mutation			NP_689695.2
XM_005259506.3	202	Silent Mutation			XP_005259563.1
XM_006722653.3	202	Silent Mutation			XP_006722716.1
XM_017026374.1	202	Silent Mutation			XP_016881863.1

Gene: PCSK4
Gene Name: proprotein convertase subtilisin/kexin type 4

There are no transcripts associated with this gene.

View Full Product Details