Product Details

SNP ID: rs192493350
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:44537382 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGGTGGGGGGCGGCGGCACTGC[C/G]GGCGGGGACCGCTGGGAAGGCGAGG
Phenotype: MIM: 603910
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CTDSPL2 PubMed Links

Gene Details

Gene: CTDSPL2
Gene Name: CTD small phosphatase like 2

There are no transcripts associated with this gene.

Gene: EIF3J
Gene Name: eukaryotic translation initiation factor 3 subunit J

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284335.1	229	Silent Mutation	GCC,GCG	A34A	NP_001271264.1
NM_001284336.1	229	Silent Mutation	GCC,GCG	A34A	NP_001271265.1
NM_003758.3	229	Silent Mutation	GCC,GCG	A34A	NP_003749.2

Gene: EIF3J-AS1
Gene Name: EIF3J antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

View Full Product Details