Product Details

SNP ID: rs201997939
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:119025739 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTCCGCGAGAGGGTGAAGAGCCA[C/G]AGTCCAGAAAGCAACATCCTAGAGG
Phenotype: MIM: 180465 MIM: 602671 MIM: 610971
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CCDC84 PubMed Links

Gene Details

Gene: CCDC84
Gene Name: coiled-coil domain containing 84

There are no transcripts associated with this gene.

Gene: MIR3656
Gene Name: microRNA 3656

There are no transcripts associated with this gene.

Gene: RPS25
Gene Name: ribosomal protein S25

There are no transcripts associated with this gene.

Gene: SLC37A4
Gene Name: solute carrier family 37 member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164277.1	1444	Intron			NP_001157749.1
NM_001164278.1	1444	Missense Mutation	CTG,GTG	L335V	NP_001157750.1
NM_001164279.1	1444	Intron			NP_001157751.1
NM_001164280.1	1444	Intron			NP_001157752.1
NM_001467.5	1444	Intron			NP_001458.1

Gene: TRAPPC4
Gene Name: trafficking protein particle complex 4

There are no transcripts associated with this gene.

View Full Product Details