Product Details

SNP ID: rs201163886
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:852908 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGGCCTCGGAGATTGTGGGGGGC[C/T]GGCGAGCGCGGCCCCACGCGTGGCC
Phenotype: MIM: 134350 MIM: 130130 MIM: 177020
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CFD PubMed Links

Gene Details

Gene: CFD
Gene Name: complement factor D

There are no transcripts associated with this gene.

Gene: ELANE
Gene Name: elastase, neutrophil expressed

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001972.3	236	Missense Mutation	CGG,TGG	R34W	NP_001963.1
XM_011527775.1	236	Missense Mutation	CGG,TGG	R34W	XP_011526077.1
XM_011527776.1	236	Missense Mutation	CGG,TGG	R34W	XP_011526078.1

Gene: PRTN3
Gene Name: proteinase 3

There are no transcripts associated with this gene.

View Full Product Details