Product Details

SNP ID: rs200727342
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2102225 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTTCTAACAAGTTGCTCAGTAGC[A/G]TGGAGTCACTGCACTTCCCGTCGAC
Phenotype: MIM: 607246
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AP3D1 PubMed Links

Gene Details

Gene: AP3D1
Gene Name: adaptor related protein complex 3 delta 1 subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001261826.1	3116	Missense Mutation	ACG,ATG	T1199M	NP_001248755.1
NM_003938.6	3116	Missense Mutation	ACG,ATG	T1137M	NP_003929.4
XM_006722932.2	3116	Missense Mutation	ACG,ATG	T1187M	XP_006722995.1
XM_017027422.1	3116	Missense Mutation	ACG,ATG	T971M	XP_016882911.1

Gene: IZUMO4
Gene Name: IZUMO family member 4

There are no transcripts associated with this gene.

Gene: MOB3A
Gene Name: MOB kinase activator 3A

There are no transcripts associated with this gene.

View Full Product Details