Product Details
- SNP ID
-
rs202186487
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:1003179 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGGGCCAGCCCCCTGGAGACGCTGC[C/T]GGATGTGCTGGTGGCGGTGCTGCAG
- Phenotype
-
MIM: 606651
MIM: 611011
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
GRIN3B
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2240154] are located under a probe and SNP(s) [rs35592366] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GRIN3B
- Gene Name
- glutamate ionotropic receptor NMDA type subunit 3B
- Gene
- LOC105372235
- Gene Name
- uncharacterized LOC105372235
There are no transcripts associated with this gene.
- Gene
- TMEM259
- Gene Name
- transmembrane protein 259
There are no transcripts associated with this gene.
- Gene
- WDR18
- Gene Name
- WD repeat domain 18
There are no transcripts associated with this gene.
View Full Product Details