Product Details
- SNP ID
-
rs17154780
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:27173191 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGGACATGAATTTTACTGCGTCCCC[A/T]CGCCCAAATATTAAAAAGCAAGTTC
- Phenotype
-
MIM: 142957
MIM: 142958
MIM: 142956
MIM: 609688
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
HOXA10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs373417573] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HOXA10
- Gene Name
- homeobox A10
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_018951.3 |
|
Intron |
|
|
NP_061824.3 |
- Gene
- HOXA10-AS
- Gene Name
- HOXA10 antisense RNA
There are no transcripts associated with this gene.
- Gene
- HOXA10-HOXA9
- Gene Name
- HOXA10-HOXA9 readthrough
There are no transcripts associated with this gene.
- Gene
- HOXA11
- Gene Name
- homeobox A11
There are no transcripts associated with this gene.
- Gene
- HOXA9
- Gene Name
- homeobox A9
There are no transcripts associated with this gene.
- Gene
- MIR196B
- Gene Name
- microRNA 196b
There are no transcripts associated with this gene.
View Full Product Details