Product Details

SNP ID: rs28480486
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:43789602 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCACAGAGTCTTCATTCAAATTACA[C/T]TGACATCTGTTTTTATGGGTCAGTG
Phenotype: MIM: 605054 MIM: 614550
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR1282 PubMed Links

Gene Details

Gene: MIR1282
Gene Name: microRNA 1282

There are no transcripts associated with this gene.

Gene: SERF2
Gene Name: small EDRK-rich factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018108.3		Intron			NP_001018118.1
NM_001199875.1		Intron			NP_001186804.1
NM_001199876.1		Intron			NP_001186805.1
NM_001199877.1		Intron			NP_001186806.1
NM_001199878.1		Intron			NP_001186807.1

Gene: SERF2-C15ORF63
Gene Name: SERF2-C15orf63 readthrough

There are no transcripts associated with this gene.

Gene: SERINC4
Gene Name: serine incorporator 4

There are no transcripts associated with this gene.

View Full Product Details