Product Details

SNP ID: rs28478232
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:11203870 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTGGAGAGCTCCCAGCTGGGTGA[A/G]TCACAAGCTGCCCTCGAGATCTGGG
Phenotype: MIM: 614194 MIM: 614610
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DOCK6 PubMed Links

Gene Details

Gene: DOCK6
Gene Name: dedicator of cytokinesis 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020812.3		Intron			NP_065863.2
XM_005260000.2		Intron			XP_005260057.1
XM_005260001.2		Intron			XP_005260058.1
XM_006722804.3		Intron			XP_006722867.1
XM_011528150.1		Intron			XP_011526452.1
XM_011528151.1		Intron			XP_011526453.1
XM_011528152.1		Intron			XP_011526454.1

Gene: KANK2
Gene Name: KN motif and ankyrin repeat domains 2

There are no transcripts associated with this gene.

Gene: LOC105372273
Gene Name: uncharacterized LOC105372273

There are no transcripts associated with this gene.

View Full Product Details