Product Details

SNP ID: rs3211583
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1962165 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACTCTGGTGTGGGTCTTGACGAGG[T/G]GGTCAGTGAACTCCTGATAGGGAGA
Phenotype: MIM: 603843 MIM: 603624 MIM: 605915
Polymorphism: T/G, Transversion Substitution
Allele Nomenclature
Literature Links: NDUFB10 PubMed Links
Additional Information: For this assay, SNP(s) [rs201507173] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: NDUFB10
Gene Name: NADH:ubiquinone oxidoreductase subunit B10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004548.2		Intron			NP_004539.1

Gene: RNF151
Gene Name: ring finger protein 151

There are no transcripts associated with this gene.

Gene: RPL3L
Gene Name: ribosomal protein L3 like

There are no transcripts associated with this gene.

Gene: RPS2
Gene Name: ribosomal protein S2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002952.3		Intron			NP_002943.2

Gene: SNHG9
Gene Name: small nucleolar RNA host gene 9

There are no transcripts associated with this gene.

Gene: SNORA10
Gene Name: small nucleolar RNA, H/ACA box 10

There are no transcripts associated with this gene.

Gene: SNORA64
Gene Name: small nucleolar RNA, H/ACA box 64

There are no transcripts associated with this gene.

Gene: SNORA78
Gene Name: small nucleolar RNA, H/ACA box 78

There are no transcripts associated with this gene.

Gene: TBL3
Gene Name: transducin beta like 3

There are no transcripts associated with this gene.

View Full Product Details