Product Details

SNP ID: rs76211155
Assay Type: Functionally tested
NCBI dbSNP Submissions: 26
Location: Chr.1:3631486 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTACCTTCCCCAGGCACCTGCACC[A/G]ACATGCAGCCCGCTGGGGACCACAG
Phenotype: MIM: 604266 MIM: 611460 MIM: 606040
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MEGF6 PubMed Links

Gene Details

Gene: MEGF6
Gene Name: multiple EGF like domains 6

There are no transcripts associated with this gene.

Gene: TPRG1L
Gene Name: tumor protein p63 regulated 1-like

There are no transcripts associated with this gene.

Gene: WRAP73
Gene Name: WD repeat containing, antisense to TP73

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017818.3	1302	Missense Mutation	TCG,TTG	S407L	NP_060288.3
XM_005244754.1	1302	Missense Mutation	TCG,TTG	S362L	XP_005244811.1
XM_017001387.1	1302	Missense Mutation	TCG,TTG	S400L	XP_016856876.1

View Full Product Details