Product Details

SNP ID: rs897004
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:44262375 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GGCTGCCTTTGACGAGATGAACAGG[A/G]ATGTTTCACATTGGCATGTTTAATC
Phenotype: MIM: 605420
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ALX4 PubMed Links
Additional Information: For this assay, SNP(s) [rs75369525] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021926.3	3819	UTR 3			NP_068745.2