Product Details

SNP ID: rs2659005
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81244914 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCCAACCATGAGGAGTGCAAAGGG[C/T]GGCACCGGCCAGTGCCCCTGGACAC
Phenotype: MIM: 616525
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C17orf89 PubMed Links

Gene Details

Gene: C17orf89
Gene Name: chromosome 17 open reading frame 89

There are no transcripts associated with this gene.

Gene: SLC38A10
Gene Name: solute carrier family 38 member 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037984.2	4420	UTR 3			NP_001033073.1
NM_138570.3	4420	Intron			NP_612637.1
XM_005257019.1	4420	Intron			XP_005257076.1
XM_011524288.1	4420	Intron			XP_011522590.1
XM_011524289.1	4420	Intron			XP_011522591.1
XM_011524290.1	4420	Intron			XP_011522592.1

Gene: TEPSIN
Gene Name: TEPSIN, adaptor related protein complex 4 accessory protein

There are no transcripts associated with this gene.

View Full Product Details