Product Details

SNP ID: rs3862143
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:43779282 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAGTAGGAAGCAACTGAGAGAGAG[A/G]ATGAGGGAGGAGTGATTGGGGTTGA
Phenotype: MIM: 609885 MIM: 602046 MIM: 605054
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ELL3 PubMed Links

Gene Details

Gene: ELL3
Gene Name: elongation factor for RNA polymerase II 3

There are no transcripts associated with this gene.

Gene: PDIA3
Gene Name: protein disulfide isomerase family A member 3

There are no transcripts associated with this gene.

Gene: SERF2
Gene Name: small EDRK-rich factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018108.3		Intron			NP_001018118.1
NM_001199875.1		Intron			NP_001186804.1
NM_001199876.1		Intron			NP_001186805.1
NM_001199877.1		Intron			NP_001186806.1
NM_001199878.1		Intron			NP_001186807.1

View Full Product Details