Product Details

SNP ID: rs155250
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2261159 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAAAAAAAAAATTGTTTCAAAAACT[A/G]TAGTACACCCAAATACTGTTCTCAA
Phenotype: MIM: 600305 MIM: 606447
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ECI1 PubMed Links

Gene Details

Gene: ECI1
Gene Name: enoyl-CoA delta isomerase 1

There are no transcripts associated with this gene.

Gene: LOC106660606
Gene Name: uncharacterized LOC106660606

There are no transcripts associated with this gene.

Gene: MIR3677
Gene Name: microRNA 3677

There are no transcripts associated with this gene.

Gene: RNPS1
Gene Name: RNA binding protein with serine rich domain 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286625.1		Intron			NP_001273554.1
NM_001286626.1		Intron			NP_001273555.1
NM_001286627.1		Intron			NP_001273556.1
NM_006711.4		Intron			NP_006702.1
NM_080594.3		Intron			NP_542161.1
XM_005255048.1		Intron			XP_005255105.1
XM_005255049.3		Intron			XP_005255106.1
XM_017022874.1		Intron			XP_016878363.1

View Full Product Details