Product Details

SNP ID: rs35681
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:10287693 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAGAATGCAGGACTTTTAAACCCAC[C/T]TGGCCCTGAAAACTGCTTTAGTCCT
Phenotype: MIM: 605353
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GHRL PubMed Links

Gene Details

Gene: GHRL
Gene Name: ghrelin/obestatin prepropeptide

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134941.2		Intron			NP_001128413.1
NM_001134944.1		Intron			NP_001128416.1
NM_001134945.1		Intron			NP_001128417.1
NM_001134946.1		Intron			NP_001128418.1
NM_001302821.1		Intron			NP_001289750.1
NM_001302822.1		Intron			NP_001289751.1
NM_001302823.1		Intron			NP_001289752.1
NM_001302824.1		Intron			NP_001289753.1
NM_001302825.1		Intron			NP_001289754.1
NM_016362.4		Intron			NP_057446.1
XM_017006612.1		Intron			XP_016862101.1
XM_017006613.1		Intron			XP_016862102.1

Gene: GHRLOS
Gene Name: ghrelin opposite strand/antisense RNA

There are no transcripts associated with this gene.

Gene: LINC00852
Gene Name: long intergenic non-protein coding RNA 852

There are no transcripts associated with this gene.

Gene: TATDN2
Gene Name: TatD DNase domain containing 2

There are no transcripts associated with this gene.

View Full Product Details