Product Details

SNP ID: rs1044139
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:66346046 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACTTCTCAGATTAGGGGAGGGAAG[A/G]GCTCAGCAGCGTCGGGGAGAGTTGG
Phenotype: MIM: 605517 MIM: 606259 MIM: 605965
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: B4GAT1 PubMed Links

Gene Details

Gene: B4GAT1
Gene Name: beta-1,4-glucuronyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006876.2	1396	UTR 3			NP_006867.1

Gene: BRMS1
Gene Name: breast cancer metastasis suppressor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024957.1	1396	Intron			NP_001020128.1
NM_015399.3	1396	Intron			NP_056214.1

Gene: LOC102724064
Gene Name: uncharacterized LOC102724064

There are no transcripts associated with this gene.

Gene: RIN1
Gene Name: Ras and Rab interactor 1

There are no transcripts associated with this gene.

View Full Product Details