Product Details

SNP ID: rs1046926
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:3630965 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTAGCCCTGTTTCTGCACACGTTAG[G/T]GCACCGCTGCTACGTGTGGCCGCCC
Phenotype: MIM: 604266 MIM: 611460 MIM: 606040
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: MEGF6 PubMed Links

Gene Details

Gene: MEGF6
Gene Name: multiple EGF like domains 6

There are no transcripts associated with this gene.

Gene: TPRG1L
Gene Name: tumor protein p63 regulated 1-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182752.3	1475	Intron			NP_877429.2

Gene: WRAP73
Gene Name: WD repeat containing, antisense to TP73

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017818.3	1475	UTR 3			NP_060288.3
XM_005244754.1	1475	UTR 3			XP_005244811.1
XM_017001387.1	1475	UTR 3			XP_016856876.1

View Full Product Details