Product Details

SNP ID: rs17627
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:39433312 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTGGTAGCGAGCGCGGGCACCAGG[A/G]CCTCCAAACTTTTTGGACTCGCAGC
Phenotype: MIM: 611893 MIM: 603675
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC723805 PubMed Links

Gene Details

Gene: LOC723805
Gene Name: interleukin-like

There are no transcripts associated with this gene.

Gene: PLEKHG2
Gene Name: pleckstrin homology and RhoGEF domain containing G2

There are no transcripts associated with this gene.

Gene: RPS16
Gene Name: ribosomal protein S16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001020.5	476	Silent Mutation	GGC,GGT	G134G	NP_001011.1
NM_001321111.1	476	Silent Mutation	GGC,GGT	G117G	NP_001308040.1
XM_005259137.2	476	Intron			XP_005259194.1

View Full Product Details