Product Details

SNP ID: rs139680221
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6477816 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGAAAGTGGCCTGGGCACTCTCAA[A/G]TCGACCACGTGTCCCTGCATCCCGG
Phenotype: MIM: 601638 MIM: 607388 MIM: 605493
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARFIP2 PubMed Links

Gene Details

Gene: ARFIP2
Gene Name: ADP ribosylation factor interacting protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242854.1	1023	Missense Mutation	CTT,TTT	L291F	NP_001229783.1
NM_001242855.1	1023	Missense Mutation	CTT,TTT	L220F	NP_001229784.1
NM_001242856.1	1023	Missense Mutation	CTT,TTT	L173F	NP_001229785.1
NM_012402.3	1023	Missense Mutation	CTT,TTT	L258F	NP_036534.1
XM_005252840.4	1023	Missense Mutation	CTT,TTT	L258F	XP_005252897.1

Gene: TIMM10B
Gene Name: translocase of inner mitochondrial membrane 10 homolog B (yeast)

There are no transcripts associated with this gene.

Gene: TRIM3
Gene Name: tripartite motif containing 3

There are no transcripts associated with this gene.

View Full Product Details