Product Details

SNP ID: rs149102058
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7933237 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCGGCAGGCGGAGGCCACGGCCC[A/G]AGCCCAGCTGTATTTACCCTCCACC
Phenotype: MIM: 611425 MIM: 604111 MIM: 610969
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNTROB PubMed Links

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037144.5	989	Missense Mutation	CAA,CGA	Q53R	NP_001032221.1
NM_053051.3	989	Missense Mutation	CAA,CGA	Q53R	NP_444279.2
XM_005256437.2	989	Missense Mutation	CAA,CGA	Q53R	XP_005256494.1
XM_005256438.2	989	Missense Mutation	CAA,CGA	Q53R	XP_005256495.1
XM_005256439.2	989	Missense Mutation	CAA,CGA	Q53R	XP_005256496.1
XM_017024128.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879617.1
XM_017024129.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879618.1
XM_017024130.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879619.1
XM_017024131.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879620.1
XM_017024132.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879621.1
XM_017024133.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879622.1
XM_017024134.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879623.1
XM_017024135.1	989	UTR 5			XP_016879624.1
XM_017024136.1	989	UTR 5			XP_016879625.1
XM_017024137.1	989	UTR 5			XP_016879626.1
XM_017024138.1	989	Intron			XP_016879627.1
XM_017024139.1	989	UTR 5			XP_016879628.1
XM_017024140.1	989	UTR 5			XP_016879629.1
XM_017024141.1	989	Missense Mutation	CAA,CGA	Q53R	XP_016879630.1
XM_017024142.1	989	UTR 5			XP_016879631.1
XM_017024143.1	989	UTR 5			XP_016879632.1
XM_017024144.1	989	UTR 5			XP_016879633.1

Gene: KCNAB3
Gene Name: potassium voltage-gated channel subfamily A regulatory beta subunit 3

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.