Product Details

SNP ID

rs140260782

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50269767 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCTCGTGGGCTCCACTGTGTCCTC[A/G]GTCTCCCACACTTTACATCCATCTT

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2060	Silent Mutation	ACC,ACT	T610T	NP_001191065.1
NM_001204137.1	2060	Intron			NP_001191066.1
NM_001204138.1	2060	Intron			NP_001191067.1
NM_001204139.1	2060	Intron			NP_001191068.1
NM_001204140.1	2060	Intron			NP_001191069.1
NM_001204141.1	2060	Intron			NP_001191070.1
NM_001204142.1	2060	UTR 3			NP_001191071.1
NM_001204143.1	2060	Missense Mutation	CCG,CTG	P506L	NP_001191072.1
NM_001204151.2	2060	UTR 3			NP_001191080.1
NM_001323942.1	2060	Silent Mutation	ACC,ACT	T635T	NP_001310871.1
NM_001323947.1	2060	Silent Mutation	ACC,ACT	T620T	NP_001310876.1
NM_001323949.1	2060	UTR 3			NP_001310878.1
NM_001323950.1	2060	UTR 3			NP_001310879.1
NM_001323951.1	2060	Intron			NP_001310880.1
NM_001323952.1	2060	UTR 3			NP_001310881.1
NM_001323953.1	2060	Intron			NP_001310882.1
NM_001323954.1	2060	Silent Mutation	ACC,ACT	T531T	NP_001310883.1
NM_002384.2	2060	UTR 3			NP_002375.1
NM_015844.2	2060	UTR 3			NP_056669.2
NM_015845.3	2060	Silent Mutation	ACC,ACT	T541T	NP_056670.2
NM_015846.3	2060	UTR 3			NP_056671.2
NM_015847.3	2060	UTR 3			NP_056723.2
XM_005258271.2	2060	UTR 3			XP_005258328.1
XM_006722456.2	2060	Missense Mutation	CCG,CTG	P633L	XP_006722519.1
XM_011525991.1	2060	Silent Mutation	ACC,ACT	T589T	XP_011524293.1
XM_011525993.2	2060	UTR 3			XP_011524295.1
XM_011525994.2	2060	UTR 3			XP_011524296.1
XM_011525998.2	2060	Intron			XP_011524300.1
XM_011525999.1	2060	Silent Mutation	ACC,ACT	T564T	XP_011524301.1
XM_011526001.1	2060	Silent Mutation	ACC,ACT	T554T	XP_011524303.1
XM_011526002.1	2060	UTR 3			XP_011524304.1
XM_011526003.2	2060	UTR 3			XP_011524305.1
XM_011526006.1	2060	Missense Mutation	CCG,CTG	P506L	XP_011524308.1
XM_011526007.1	2060	UTR 3			XP_011524309.1
XM_017025751.1	2060	Missense Mutation	CCG,CTG	P618L	XP_016881240.1
XM_017025752.1	2060	Silent Mutation	ACC,ACT	T595T	XP_016881241.1
XM_017025753.1	2060	Missense Mutation	CCG,CTG	P608L	XP_016881242.1
XM_017025754.1	2060	Intron			XP_016881243.1
XM_017025755.1	2060	Intron			XP_016881244.1
XM_017025756.1	2060	Missense Mutation	CCG,CTG	P587L	XP_016881245.1
XM_017025757.1	2060	UTR 3			XP_016881246.1
XM_017025758.1	2060	UTR 3			XP_016881247.1
XM_017025759.1	2060	UTR 3			XP_016881248.1
XM_017025760.1	2060	UTR 3			XP_016881249.1
XM_017025761.1	2060	Intron			XP_016881250.1
XM_017025762.1	2060	UTR 3			XP_016881251.1
XM_017025763.1	2060	UTR 3			XP_016881252.1
XM_017025764.1	2060	UTR 3			XP_016881253.1
XM_017025765.1	2060	Missense Mutation	CCG,CTG	P552L	XP_016881254.1
XM_017025766.1	2060	UTR 3			XP_016881255.1
XM_017025767.1	2060	UTR 3			XP_016881256.1
XM_017025768.1	2060	Intron			XP_016881257.1
XM_017025769.1	2060	UTR 3			XP_016881258.1
XM_017025770.1	2060	UTR 3			XP_016881259.1
XM_017025771.1	2060	UTR 3			XP_016881260.1
XM_017025772.1	2060	Intron			XP_016881261.1
XM_017025773.1	2060	UTR 3			XP_016881262.1
XM_017025774.1	2060	UTR 3			XP_016881263.1
XM_017025775.1	2060	Intron			XP_016881264.1
XM_017025776.1	2060	UTR 3			XP_016881265.1
XM_017025777.1	2060	Intron			XP_016881266.1

View Full Product Details