Product Details

SNP ID

rs142649735

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50269019 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATTAAATTCCATGATAAAGTTGGAA[A/G]TCCATTCACCATTTGTAATACATAT

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2808	UTR 3			NP_001191065.1
NM_001204137.1	2808	Intron			NP_001191066.1
NM_001204138.1	2808	Intron			NP_001191067.1
NM_001204139.1	2808	Intron			NP_001191068.1
NM_001204140.1	2808	Intron			NP_001191069.1
NM_001204141.1	2808	Intron			NP_001191070.1
NM_001204142.1	2808	UTR 3			NP_001191071.1
NM_001204143.1	2808	UTR 3			NP_001191072.1
NM_001204151.2	2808	UTR 3			NP_001191080.1
NM_001323942.1	2808	UTR 3			NP_001310871.1
NM_001323947.1	2808	UTR 3			NP_001310876.1
NM_001323949.1	2808	UTR 3			NP_001310878.1
NM_001323950.1	2808	UTR 3			NP_001310879.1
NM_001323951.1	2808	Intron			NP_001310880.1
NM_001323952.1	2808	UTR 3			NP_001310881.1
NM_001323953.1	2808	Intron			NP_001310882.1
NM_001323954.1	2808	UTR 3			NP_001310883.1
NM_002384.2	2808	UTR 3			NP_002375.1
NM_015844.2	2808	UTR 3			NP_056669.2
NM_015845.3	2808	UTR 3			NP_056670.2
NM_015846.3	2808	UTR 3			NP_056671.2
NM_015847.3	2808	UTR 3			NP_056723.2
XM_005258271.2	2808	UTR 3			XP_005258328.1
XM_006722456.2	2808	UTR 3			XP_006722519.1
XM_011525991.1	2808	UTR 3			XP_011524293.1
XM_011525993.2	2808	UTR 3			XP_011524295.1
XM_011525994.2	2808	UTR 3			XP_011524296.1
XM_011525998.2	2808	Intron			XP_011524300.1
XM_011525999.1	2808	UTR 3			XP_011524301.1
XM_011526001.1	2808	UTR 3			XP_011524303.1
XM_011526002.1	2808	UTR 3			XP_011524304.1
XM_011526003.2	2808	UTR 3			XP_011524305.1
XM_011526006.1	2808	UTR 3			XP_011524308.1
XM_011526007.1	2808	UTR 3			XP_011524309.1
XM_017025751.1	2808	UTR 3			XP_016881240.1
XM_017025752.1	2808	UTR 3			XP_016881241.1
XM_017025753.1	2808	UTR 3			XP_016881242.1
XM_017025754.1	2808	Intron			XP_016881243.1
XM_017025755.1	2808	Intron			XP_016881244.1
XM_017025756.1	2808	UTR 3			XP_016881245.1
XM_017025757.1	2808	UTR 3			XP_016881246.1
XM_017025758.1	2808	UTR 3			XP_016881247.1
XM_017025759.1	2808	UTR 3			XP_016881248.1
XM_017025760.1	2808	UTR 3			XP_016881249.1
XM_017025761.1	2808	Intron			XP_016881250.1
XM_017025762.1	2808	UTR 3			XP_016881251.1
XM_017025763.1	2808	UTR 3			XP_016881252.1
XM_017025764.1	2808	UTR 3			XP_016881253.1
XM_017025765.1	2808	UTR 3			XP_016881254.1
XM_017025766.1	2808	UTR 3			XP_016881255.1
XM_017025767.1	2808	UTR 3			XP_016881256.1
XM_017025768.1	2808	Intron			XP_016881257.1
XM_017025769.1	2808	UTR 3			XP_016881258.1
XM_017025770.1	2808	UTR 3			XP_016881259.1
XM_017025771.1	2808	UTR 3			XP_016881260.1
XM_017025772.1	2808	Intron			XP_016881261.1
XM_017025773.1	2808	UTR 3			XP_016881262.1
XM_017025774.1	2808	UTR 3			XP_016881263.1
XM_017025775.1	2808	Intron			XP_016881264.1
XM_017025776.1	2808	UTR 3			XP_016881265.1
XM_017025777.1	2808	Intron			XP_016881266.1

View Full Product Details