Product Details

SNP ID: rs141087932
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:14093123 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCACAGGCATGCCCCTAAAACTCAG[A/G]AAACTCCTTGCCACACTTCTCATTG
Phenotype: MIM: 601639
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C19orf67 PubMed Links

Gene Details

Gene: C19orf67
Gene Name: chromosome 19 open reading frame 67

There are no transcripts associated with this gene.

Gene: PRKACA
Gene Name: protein kinase cAMP-activated catalytic subunit alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304349.1	1679	Missense Mutation	CCT,TCT	P425S	NP_001291278.1
NM_002730.3	1679	Missense Mutation	CCT,TCT	P349S	NP_002721.1
NM_207518.2	1679	Intron			NP_997401.1
XM_017026948.1	1679	Intron			XP_016882437.1

Gene: SAMD1
Gene Name: sterile alpha motif domain containing 1

There are no transcripts associated with this gene.

View Full Product Details