Product Details
- SNP ID
-
rs149309849
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.21:30487304 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATCCTTCATAGCCGCAGCCATAGCC[C/T]AGTCTGCAGAAGCTGCCACATCCAC
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KRTAP19-1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs6516970] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRTAP19-1
- Gene Name
- keratin associated protein 19-1
There are no transcripts associated with this gene.
- Gene
- KRTAP19-2
- Gene Name
- keratin associated protein 19-2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_181608.1 |
45 |
Silent Mutation |
CTA,CTG |
L15L |
NP_853639.1 |
- Gene
- KRTAP19-3
- Gene Name
- keratin associated protein 19-3
There are no transcripts associated with this gene.
- Gene
- KRTAP19-4
- Gene Name
- keratin associated protein 19-4
There are no transcripts associated with this gene.
View Full Product Details