Product Details

SNP ID: rs144374953
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:37944447 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGATTTCAGCAAGGATGATTCCTCG[A/G]TACTGTTTGCCCTGTCCCAGGGCCT
Phenotype: MIM: 604414
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C22orf23 PubMed Links

Gene Details

Gene: C22orf23
Gene Name: chromosome 22 open reading frame 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207062.1	605	Silent Mutation	TAC,TAT	Y163Y	NP_001193991.1
NM_032561.4	605	Silent Mutation	TAC,TAT	Y184Y	NP_115950.3
XM_005261781.1	605	Silent Mutation	TAC,TAT	Y184Y	XP_005261838.1
XM_005261782.3	605	Silent Mutation	TAC,TAT	Y184Y	XP_005261839.1
XM_005261783.2	605	Silent Mutation	TAC,TAT	Y163Y	XP_005261840.1
XM_005261784.2	605	Silent Mutation	TAC,TAT	Y163Y	XP_005261841.1

Gene: MICALL1
Gene Name: MICAL like 1

There are no transcripts associated with this gene.

Gene: POLR2F
Gene Name: RNA polymerase II subunit F

There are no transcripts associated with this gene.

View Full Product Details