Product Details

SNP ID: rs146016925
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:218271414 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGAGCCACAGCTAACAAGGCTT[A/C]TCATAACAGGACCCGGGCCCTGCAA
Phenotype: MIM: 603488 MIM: 610147 MIM: 609023 MIM: 610364
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: AAMP PubMed Links

Gene Details

Gene: AAMP
Gene Name: angio associated migratory cell protein

There are no transcripts associated with this gene.

Gene: GPBAR1
Gene Name: G protein-coupled bile acid receptor 1

There are no transcripts associated with this gene.

Gene: MIR6513
Gene Name: microRNA 6513

There are no transcripts associated with this gene.

Gene: PNKD
Gene Name: paroxysmal nonkinesigenic dyskinesia

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077399.2	245	Intron			NP_001070867.1
NM_015488.4	245	Missense Mutation	TAT,TCT	Y34S	NP_056303.3
NM_022572.4	245	Intron			NP_072094.1
XM_017003771.1	245	Missense Mutation	TAT,TCT	Y34S	XP_016859260.1
XM_017003772.1	245	Intron			XP_016859261.1

Gene: TMBIM1
Gene Name: transmembrane BAX inhibitor motif containing 1

There are no transcripts associated with this gene.

View Full Product Details