Product Details

SNP ID
rs139877036
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.6:26445979 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCTGGAAAAGACAGCCAGCATATCC[A/G]TCGCAGGTCAGTACCCTGCTTGGCC
Phenotype
MIM: 613594 MIM: 613595
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
BTN3A2 PubMed Links
Additional Information
For this assay, SNP(s) [rs3846848] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
BTN3A2
Gene Name
butyrophilin subfamily 3 member A2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001197246.2 881 Intron NP_001184175.1
NM_001197247.2 881 Intron NP_001184176.1
NM_001197248.2 881 Intron NP_001184177.1
NM_001197249.2 881 Intron NP_001184178.1
NM_007047.4 881 Intron NP_008978.2
XM_005248827.3 881 Intron XP_005248884.1
XM_005248831.3 881 Intron XP_005248888.1
XM_005248832.3 881 Intron XP_005248889.1
XM_006714979.3 881 Intron XP_006715042.1
XM_006714980.3 881 Intron XP_006715043.1
XM_006714981.3 881 Intron XP_006715044.1
XM_006714982.3 881 Intron XP_006715045.1
XM_011514267.2 881 Intron XP_011512569.1
XM_011514268.2 881 Intron XP_011512570.1
XM_011514269.2 881 Intron XP_011512571.1
XM_011514270.2 881 Intron XP_011512572.1
XM_011514271.2 881 Intron XP_011512573.1
XM_017010211.1 881 Intron XP_016865700.1
XM_017010212.1 881 Intron XP_016865701.1
XM_017010213.1 881 Intron XP_016865702.1
XM_017010214.1 881 Intron XP_016865703.1
XM_017010215.1 881 Intron XP_016865704.1
XM_017010216.1 881 Intron XP_016865705.1
XM_017010217.1 881 Intron XP_016865706.1
Gene
BTN3A3
Gene Name
butyrophilin subfamily 3 member A3
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001242803.1 881 Intron NP_001229732.1
NM_006994.4 881 Missense Mutation ATC,GTC I237V NP_008925.1
NM_197974.2 881 Missense Mutation ATC,GTC I195V NP_932078.2

View Full Product Details