Product Details

SNP ID: rs145484365
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100613549 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCGCTTCCGCATTGAGCTGTCTGA[A/G]GAAGGAGCTGAGGGCCGAGTGGTGG
Phenotype: MIM: 609125 MIM: 600270 MIM: 604720
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MOSPD3 PubMed Links

Gene Details

Gene: MOSPD3
Gene Name: motile sperm domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040097.1	502	Silent Mutation	GAA,GAG	E118E	NP_001035186.1
NM_001040098.1	502	Silent Mutation	GAA,GAG	E118E	NP_001035187.1
NM_001040099.1	502	Silent Mutation	GAA,GAG	E108E	NP_001035188.1
NM_023948.4	502	Silent Mutation	GAA,GAG	E118E	NP_076438.1
XM_005250529.4	502	Silent Mutation	GAA,GAG	E118E	XP_005250586.1
XM_005250531.3	502	Silent Mutation	GAA,GAG	E118E	XP_005250588.1

Gene: PCOLCE
Gene Name: procollagen C-endopeptidase enhancer

There are no transcripts associated with this gene.

Gene: PCOLCE-AS1
Gene Name: PCOLCE antisense RNA 1

There are no transcripts associated with this gene.

Gene: TFR2
Gene Name: transferrin receptor 2

There are no transcripts associated with this gene.

View Full Product Details