Product Details
- SNP ID
-
rs143889132
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:136116798 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACGTCGAAGTTGTTGTACTTGGTGC[A/G]GGCCAGGTGGGAGGCGCGCACGGGC
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C9orf69
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs3739466] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C9orf69
- Gene Name
- chromosome 9 open reading frame 69
- Gene
- LOC105376323
- Gene Name
- uncharacterized LOC105376323
There are no transcripts associated with this gene.
- Gene
- LOC107987142
- Gene Name
- translation initiation factor IF-2-like
There are no transcripts associated with this gene.
View Full Product Details