Product Details

SNP ID

rs183864846

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50270029 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CATGAGTCTAAATGTCAATCAAATA[A/C]ATTTCATATAGATCATTGTCAAAAT

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

A/C, Transversion substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2072	Intron			NP_001191065.1
NM_001204137.1	2072	Intron			NP_001191066.1
NM_001204138.1	2072	Intron			NP_001191067.1
NM_001204139.1	2072	Intron			NP_001191068.1
NM_001204140.1	2072	Intron			NP_001191069.1
NM_001204141.1	2072	Intron			NP_001191070.1
NM_001204142.1	2072	Missense Mutation	ATG,ATT	M545I	NP_001191071.1
NM_001204143.1	2072	Intron			NP_001191072.1
NM_001204151.2	2072	Intron			NP_001191080.1
NM_001323942.1	2072	Intron			NP_001310871.1
NM_001323947.1	2072	Intron			NP_001310876.1
NM_001323949.1	2072	Intron			NP_001310878.1
NM_001323950.1	2072	Intron			NP_001310879.1
NM_001323951.1	2072	Intron			NP_001310880.1
NM_001323952.1	2072	Intron			NP_001310881.1
NM_001323953.1	2072	Intron			NP_001310882.1
NM_001323954.1	2072	Intron			NP_001310883.1
NM_002384.2	2072	Intron			NP_002375.1
NM_015844.2	2072	Intron			NP_056669.2
NM_015845.3	2072	Intron			NP_056670.2
NM_015846.3	2072	Intron			NP_056671.2
NM_015847.3	2072	Intron			NP_056723.2
XM_005258271.2	2072	UTR 3			XP_005258328.1
XM_006722456.2	2072	Intron			XP_006722519.1
XM_011525991.1	2072	Intron			XP_011524293.1
XM_011525993.2	2072	Intron			XP_011524295.1
XM_011525994.2	2072	Intron			XP_011524296.1
XM_011525998.2	2072	Intron			XP_011524300.1
XM_011525999.1	2072	Intron			XP_011524301.1
XM_011526001.1	2072	Intron			XP_011524303.1
XM_011526002.1	2072	UTR 3			XP_011524304.1
XM_011526003.2	2072	Intron			XP_011524305.1
XM_011526006.1	2072	Intron			XP_011524308.1
XM_011526007.1	2072	UTR 3			XP_011524309.1
XM_017025751.1	2072	Intron			XP_016881240.1
XM_017025752.1	2072	Intron			XP_016881241.1
XM_017025753.1	2072	Intron			XP_016881242.1
XM_017025754.1	2072	Intron			XP_016881243.1
XM_017025755.1	2072	Intron			XP_016881244.1
XM_017025756.1	2072	Intron			XP_016881245.1
XM_017025757.1	2072	UTR 3			XP_016881246.1
XM_017025758.1	2072	Intron			XP_016881247.1
XM_017025759.1	2072	Intron			XP_016881248.1
XM_017025760.1	2072	Intron			XP_016881249.1
XM_017025761.1	2072	Intron			XP_016881250.1
XM_017025762.1	2072	Intron			XP_016881251.1
XM_017025763.1	2072	UTR 3			XP_016881252.1
XM_017025764.1	2072	Intron			XP_016881253.1
XM_017025765.1	2072	Intron			XP_016881254.1
XM_017025766.1	2072	Intron			XP_016881255.1
XM_017025767.1	2072	Intron			XP_016881256.1
XM_017025768.1	2072	Intron			XP_016881257.1
XM_017025769.1	2072	Intron			XP_016881258.1
XM_017025770.1	2072	UTR 3			XP_016881259.1
XM_017025771.1	2072	Intron			XP_016881260.1
XM_017025772.1	2072	Intron			XP_016881261.1
XM_017025773.1	2072	UTR 3			XP_016881262.1
XM_017025774.1	2072	Intron			XP_016881263.1
XM_017025775.1	2072	Intron			XP_016881264.1
XM_017025776.1	2072	UTR 3			XP_016881265.1
XM_017025777.1	2072	Intron			XP_016881266.1

View Full Product Details