Product Details

SNP ID: rs186459407
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6943901 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCTTATGATGTTTGTTGCCAATG[A/G]TAGATTGTTTTCACTGTGCAAAAAT
Phenotype: MIM: 607462 MIM: 615140 MIM: 176883
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATN1 PubMed Links

Gene Details

Gene: ATN1
Gene Name: atrophin 1

There are no transcripts associated with this gene.

Gene: C12orf57
Gene Name: chromosome 12 open reading frame 57

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301834.1	85	Intron			NP_001288763.1
NM_001301836.1	85	Intron			NP_001288765.1
NM_001301837.1	85	UTR 5			NP_001288766.1
NM_001301838.1	85	UTR 5			NP_001288767.1
NM_138425.3	85	UTR 5			NP_612434.1

Gene: PTPN6
Gene Name: protein tyrosine phosphatase, non-receptor type 6

There are no transcripts associated with this gene.

Gene: RNU7-1
Gene Name: RNA, U7 small nuclear 1

There are no transcripts associated with this gene.

View Full Product Details