Product Details

SNP ID: rs187700226
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219249957 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCCTTGCTTCCAGAGTTGGTAAA[T/C]GTAGAGGCAGCAGGAAGAACAGGGT
Phenotype: MIM: 604719 MIM: 191110
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: GLB1L PubMed Links

Gene Details

Gene: GLB1L
Gene Name: galactosidase beta 1 like

There are no transcripts associated with this gene.

Gene: STK16
Gene Name: serine/threonine kinase 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011512067.2	2378	UTR 3			XP_011510369.1
XM_017005160.1	2378	Intron			XP_016860649.1

Gene: TUBA4A
Gene Name: tubulin alpha 4a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278552.1	2378	UTR 3			NP_001265481.1
NM_006000.2	2378	UTR 3			NP_005991.1
XM_017004824.1	2378	Intron			XP_016860313.1

Gene: TUBA4B
Gene Name: tubulin alpha 4b

There are no transcripts associated with this gene.

View Full Product Details