Product Details

SNP ID: rs188958425
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:12975005 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAATACAAATCCAATAATTTTAGAA[A/C]ATCAGTTTTTAGTGACCCAGATGCC
Phenotype: MIM: 605826
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM234B PubMed Links

Gene Details

Gene: FAM234B
Gene Name: family with sequence similarity 234 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020853.1	1068	Intron			NP_065904.1
XM_017019706.1	1068	Intron			XP_016875195.1

Gene: HEBP1
Gene Name: heme binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015987.4	1068	UTR 3			NP_057071.2

Gene: LOC100506314
Gene Name: uncharacterized LOC100506314

There are no transcripts associated with this gene.

View Full Product Details