Product Details
- SNP ID
-
rs200141774
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:58155746 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACTGATACCTCCCTCCTGGAGTTCC[C/T]CATGATCTCCAACAGTGGGCTGCTA
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MSX2P1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7218964] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MSX2P1
- Gene Name
- msh homeobox 2 pseudogene 1
There are no transcripts associated with this gene.
- Gene
- OR4D1
- Gene Name
- olfactory receptor family 4 subfamily D member 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_012374.1 |
593 |
Missense Mutation |
CCC,CTC |
P198L |
NP_036506.1 |
View Full Product Details