Product Details

SNP ID: rs199842928
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48713365 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGGTGGGGGACCAGAACCCAGAG[A/G]AGGACCCCCGCTCAGGGCCTCCAGC
Phenotype: MIM: 182100 MIM: 610349 MIM: 609623
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: FUT2 PubMed Links
Additional Information: For this assay, SNP(s) [rs554363978] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.

Gene: MAMSTR
Gene Name: MEF2 activating motif and SAP domain containing transcriptional regulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130915.1	1980	Missense Mutation	CCT,TCT	P384S	NP_001124387.1
NM_001297753.1	1980	Missense Mutation	CCT,TCT	P216S	NP_001284682.1
NM_182574.2	1980	Missense Mutation	CCT,TCT	P281S	NP_872380.1
XM_011526807.2	1980	Missense Mutation	CCT,TCT	P281S	XP_011525109.1
XM_011526808.2	1980	Missense Mutation	CCT,TCT	P447S	XP_011525110.1
XM_011526809.2	1980	Missense Mutation	CCT,TCT	P216S	XP_011525111.1
XM_017026640.1	1980	Missense Mutation	CCT,TCT	P465S	XP_016882129.1
XM_017026641.1	1980	Missense Mutation	CCT,TCT	P452S	XP_016882130.1
XM_017026642.1	1980	Intron			XP_016882131.1
XM_017026643.1	1980	Missense Mutation	CCT,TCT	P412S	XP_016882132.1
XM_017026644.1	1980	Missense Mutation	CCT,TCT	P402S	XP_016882133.1
XM_017026645.1	1980	Missense Mutation	CCT,TCT	P216S	XP_016882134.1

There are no transcripts associated with this gene.