Product Details

SNP ID: rs199808095
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49174348 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGGCTTTCGCTACCCTCCATGCC[C/T]ACACCCTGCTATGGGGCCTCCACCT
Phenotype: MIM: 613169
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C3orf84 PubMed Links

Gene Details

Gene: C3orf84
Gene Name: chromosome 3 open reading frame 84

There are no transcripts associated with this gene.

Gene: CCDC71
Gene Name: coiled-coil domain containing 71

There are no transcripts associated with this gene.

Gene: KLHDC8B
Gene Name: kelch domain containing 8B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_173546.2	1216	Silent Mutation	CCC,CCT	P162P	NP_775817.1
XM_005264938.2	1216	Silent Mutation	CCC,CCT	P162P	XP_005264995.1
XM_005264940.4	1216	Silent Mutation	CCC,CCT	P35P	XP_005264997.1
XM_006713015.2	1216	Silent Mutation	CCC,CCT	P172P	XP_006713078.1
XM_006713016.2	1216	Silent Mutation	CCC,CCT	P172P	XP_006713079.1

View Full Product Details