Product Details

SNP ID: rs200247408
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:177303202 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATAAGGCCCCACCAGAAAGCGGTC[A/G]TGCACGTAGCGCTCCACCAGGCTAG
Phenotype: MIM: 609450 MIM: 606681 MIM: 605733 MIM: 612415
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MXD3 PubMed Links

Gene Details

Gene: MXD3
Gene Name: MAX dimerization protein 3

There are no transcripts associated with this gene.

Gene: NSD1
Gene Name: nuclear receptor binding SET domain protein 1

There are no transcripts associated with this gene.

Gene: PRELID1
Gene Name: PRELI domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271828.1	457	Intron			NP_001258757.1
NM_013237.3	457	Intron			NP_037369.1

Gene: RAB24
Gene Name: RAB24, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031677.3	457	Silent Mutation	CAC,CAT	H29H	NP_001026847.1
NM_130781.3	457	Silent Mutation	CAC,CAT	H29H	NP_570137.2

View Full Product Details