Product Details

SNP ID: rs34516207
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:109089410 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGCCCCAGGGGACAGGTATTGGGGG[A/G]TGGGGGACACTACTTGCAATCTAGT
Phenotype: MIM: 610602 MIM: 191525 MIM: 612492
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALKBH2 PubMed Links

Gene Details

Gene: ALKBH2
Gene Name: alkB homolog 2, alpha-ketoglutarate dependent dioxygenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001655.2		Intron			NP_001001655.1
NM_001145374.1		Intron			NP_001138846.1
NM_001145375.1		Intron			NP_001138847.1
NM_001205179.1		Intron			NP_001192108.1
NM_001205180.1		Intron			NP_001192109.1
XM_005253835.4		Intron			XP_005253892.1
XM_005253836.1		Intron			XP_005253893.1

Gene: UNG
Gene Name: uracil DNA glycosylase

There are no transcripts associated with this gene.

Gene: USP30
Gene Name: ubiquitin specific peptidase 30

There are no transcripts associated with this gene.

View Full Product Details