Product Details

SNP ID
rs2407580
Assay Type
Functionally Tested
NCBI dbSNP Submissions
34
Location
Chr.1:59305198 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
AGTATCATATTGGCTTTGGGCTTGT[A/C]ATATATAGTCTGTATAATGTTGAGG
Phenotype
MIM: 611370
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
FGGY PubMed Links
Additional Information
For this assay, SNP(s) [rs80121543] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
FGGY
Gene Name
FGGY carbohydrate kinase domain containing
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001113411.1 Intron NP_001106882.1
NM_001244714.1 Intron NP_001231643.1
NM_001278224.1 Intron NP_001265153.1
NM_018291.3 Intron NP_060761.3
XM_011541730.1 Intron XP_011540032.1
XM_011541731.1 Intron XP_011540033.1
XM_011541732.1 Intron XP_011540034.1
XM_011541733.1 Intron XP_011540035.1
XM_011541735.1 Intron XP_011540037.1
XM_011541736.2 Intron XP_011540038.1
XM_017001643.1 Intron XP_016857132.1
XM_017001644.1 Intron XP_016857133.1
XM_017001645.1 Intron XP_016857134.1
XM_017001646.1 Intron XP_016857135.1
XM_017001647.1 Intron XP_016857136.1
XM_017001648.1 Intron XP_016857137.1
XM_017001649.1 Intron XP_016857138.1
XM_017001650.1 Intron XP_016857139.1
XM_017001651.1 Intron XP_016857140.1
XM_017001652.1 Intron XP_016857141.1
XM_017001653.1 Intron XP_016857142.1
XM_017001654.1 Intron XP_016857143.1
XM_017001655.1 Intron XP_016857144.1
XM_017001656.1 Intron XP_016857145.1
XM_017001657.1 Intron XP_016857146.1
XM_017001658.1 Intron XP_016857147.1
XM_017001659.1 Intron XP_016857148.1
XM_017001660.1 Intron XP_016857149.1
XM_017001661.1 Intron XP_016857150.1
XM_017001662.1 Intron XP_016857151.1
XM_017001663.1 Intron XP_016857152.1
XM_017001664.1 Intron XP_016857153.1
XM_017001665.1 Intron XP_016857154.1
XM_017001666.1 Intron XP_016857155.1
XM_017001667.1 Intron XP_016857156.1
XM_017001668.1 Intron XP_016857157.1
XM_017001669.1 Intron XP_016857158.1
XM_017001670.1 Intron XP_016857159.1
XM_017001671.1 Intron XP_016857160.1
XM_017001672.1 Intron XP_016857161.1
XM_017001673.1 Intron XP_016857162.1
XM_017001674.1 Intron XP_016857163.1
XM_017001675.1 Intron XP_016857164.1
XM_017001676.1 Intron XP_016857165.1
XM_017001677.1 Intron XP_016857166.1
XM_017001678.1 Intron XP_016857167.1
XM_017001679.1 Intron XP_016857168.1

View Full Product Details